|
MedChemExpress
necrostatin 1 Necrostatin 1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/necrostatin 1/product/MedChemExpress Average 96 stars, based on 1 article reviews
necrostatin 1 - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
TargetMol
necrostatin 1 Necrostatin 1, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/necrostatin 1/product/TargetMol Average 93 stars, based on 1 article reviews
necrostatin 1 - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
necrostatin 1 nec 1 Necrostatin 1 Nec 1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/necrostatin 1 nec 1/product/Santa Cruz Biotechnology Average 93 stars, based on 1 article reviews
necrostatin 1 nec 1 - by Bioz Stars,
2026-05
93/100 stars
|
Buy from Supplier |
|
AnaSpec
g2ct ![]() G2ct, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/g2ct/product/AnaSpec Average 90 stars, based on 1 article reviews
g2ct - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
AnaSpec
reverse aβ 42-1 as-27276 ![]() Reverse Aβ 42 1 As 27276, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reverse aβ 42-1 as-27276/product/AnaSpec Average 90 stars, based on 1 article reviews
reverse aβ 42-1 as-27276 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Bachem
selective par-1 agonist tfllr-amide tfllr-nh 2 ![]() Selective Par 1 Agonist Tfllr Amide Tfllr Nh 2, supplied by Bachem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/selective par-1 agonist tfllr-amide tfllr-nh 2/product/Bachem Average 90 stars, based on 1 article reviews
selective par-1 agonist tfllr-amide tfllr-nh 2 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Bachem
grgesp peptides ![]() Grgesp Peptides, supplied by Bachem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/grgesp peptides/product/Bachem Average 90 stars, based on 1 article reviews
grgesp peptides - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Genotech Corp
control odn 1720 (tccatgagcttcctgatgct, inactive control for cpg odn 1668) ![]() Control Odn 1720 (Tccatgagcttcctgatgct, Inactive Control For Cpg Odn 1668), supplied by Genotech Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/control odn 1720 (tccatgagcttcctgatgct, inactive control for cpg odn 1668)/product/Genotech Corp Average 90 stars, based on 1 article reviews
control odn 1720 (tccatgagcttcctgatgct, inactive control for cpg odn 1668) - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
PolyPeptide Laboratories
inactive negative control peptide ![]() Inactive Negative Control Peptide, supplied by PolyPeptide Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/inactive negative control peptide/product/PolyPeptide Laboratories Average 90 stars, based on 1 article reviews
inactive negative control peptide - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
inactive control peptide (2 mm) ![]() Inactive Control Peptide (2 Mm), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/inactive control peptide (2 mm)/product/GenScript corporation Average 90 stars, based on 1 article reviews
inactive control peptide (2 mm) - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
LifeTein Inc
inactive control peptide tg3 ![]() Inactive Control Peptide Tg3, supplied by LifeTein Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/inactive control peptide tg3/product/LifeTein Inc Average 90 stars, based on 1 article reviews
inactive control peptide tg3 - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Mebio Inc
kinase-inactive control ![]() Kinase Inactive Control, supplied by Mebio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/kinase-inactive control/product/Mebio Inc Average 90 stars, based on 1 article reviews
kinase-inactive control - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: The Journal of Neuroscience
Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories
doi: 10.1523/JNEUROSCI.3333-15.2016
Figure Lengend Snippet: Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: G2CT). C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Article Snippet: The
Techniques:
Journal: The Journal of Neuroscience
Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories
doi: 10.1523/JNEUROSCI.3333-15.2016
Figure Lengend Snippet: Interfering with AP2-dependent GluA2/AMPAR removal and delayed onset of GluA23Y infusions prevent forgetting of long-term object location memories. A–C, Inhibiting AP2-dependent synaptic removal of GluA2/AMPARs prevents forgetting (see Fig. 8B for cannula placements). A, Animals were trained as before (Fig. 1D), but instead of GluA23Y, the peptide G2CT (n = 7, inactive control peptide, Ctrl, n = 7) was infused to interfere with the binding of AP2 to GluA2 to attenuate activity-dependent synaptic removal of GluA2/AMPARs. B, Only animals infused with G2CT preferred exploring the object at the new location, expressing significantly stronger novelty preference than the animals infused with the inactive control peptide (Ctrl). C, There were no group differences in exploratory activity. D–F, Infusing GluA23Y can prolong remote memories shortly before they would be naturally forgotten (see Fig. 8C for cannula placements). D, Seven days after the last training session (i.e., on day 8 after training), shortly before rats normally would forget the location memory (see Fig. 1A–C), animals received GluA23Y infusions into the dorsal hippocampus twice daily for 6 d. Twenty-four hours after the last infusion (or 14 d after the end of training), memory for object location was assessed by moving one of the objects to a novel location. E, Animals infused with GluA23Y (n = 7) preferred to explore the object at the new location, whereas animals that had received the inactive control variant (Ctrl, n = 6) explored both objects for an equal amount of time. The group difference was significant. F, Exploratory activity was the same for both groups.
Article Snippet: The
Techniques: Binding Assay, Activity Assay, Expressing, Variant Assay
Journal: The Journal of Neuroscience
Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories
doi: 10.1523/JNEUROSCI.3333-15.2016
Figure Lengend Snippet: Exploratory behavior during training sessions
Article Snippet: The
Techniques:
Journal: HemaSphere
Article Title: Myb overexpression synergizes with the loss of Pten and is a dependency factor and therapeutic target in T‐cell lymphoblastic leukemia
doi: 10.1002/hem3.51
Figure Lengend Snippet: Peptidomimetic blockade of MYB triggers cell death in T‐ALL. (A, B) Line chart of the ratio of luminescence detected using CellTiter‐Glo cell viability assay (hereafter called relative viability) upon treatment of cell lines with 10–40 µM of MYBMIM (colored line) or its inactive version, named TG3 (black line), normalized to the untreated condition. (A) MyPL1 and MyPL2 are murine R26‐Myb tg/tg ; Pten fl/fl ; Lck‐Cre tg/+ T‐ALL cell lines. (B) RPMI‐8402, P12‐Ichikawa, Loucy, KOPT‐K1, and Jurkat are human T‐ALL cell lines. (C) Bar chart showing the relative viability of Jurkat and KOPT‐K1 cells at the beginning of the experiment (0 h), and 48 h later, when treated with either 30 µM (for Jurkat) or 20 µM (for KOPT‐K1) of MYBMIM, TG3, or untreated (CTR 48 h). (D) Stacked bar charts showing the percentage of cells per phase of the cell cycle and (E) the percentage of viable, early apoptotic, or late apoptotic cells at 48 h. A representative result from two independent experiments is shown. (F) Scheme of generation of T‐ALL patient‐derived xenografts (PDXs) through intravenous injections, followed by their ex vivo treatment with either TG3 or MYBMIM. (G) Line chart of the relative viability of T‐ALL PDX with either chromosomal translocation ( TRB::MYB ), genomic gain of MYB ( MYB CNG), or wild‐type MYB ( MYB WT), upon treatment with 10–40 µM of MYBMIM (colored line) or TG3 (black line), normalized to the untreated condition.
Article Snippet: Murine and human T‐ALL cells were cultured at a density of 10,000 cells/mL and treated with either the peptidomimetic MYBMIM or the
Techniques: Viability Assay, Derivative Assay, Ex Vivo, Translocation Assay