inactive control Search Results


96
MedChemExpress necrostatin 1
Necrostatin 1, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/necrostatin 1/product/MedChemExpress
Average 96 stars, based on 1 article reviews
necrostatin 1 - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

93
TargetMol necrostatin 1
Necrostatin 1, supplied by TargetMol, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/necrostatin 1/product/TargetMol
Average 93 stars, based on 1 article reviews
necrostatin 1 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology necrostatin 1 nec 1
Necrostatin 1 Nec 1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/necrostatin 1 nec 1/product/Santa Cruz Biotechnology
Average 93 stars, based on 1 article reviews
necrostatin 1 nec 1 - by Bioz Stars, 2026-05
93/100 stars
  Buy from Supplier

90
AnaSpec g2ct
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
G2ct, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/g2ct/product/AnaSpec
Average 90 stars, based on 1 article reviews
g2ct - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
AnaSpec reverse aβ 42-1 as-27276
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Reverse Aβ 42 1 As 27276, supplied by AnaSpec, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reverse aβ 42-1 as-27276/product/AnaSpec
Average 90 stars, based on 1 article reviews
reverse aβ 42-1 as-27276 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Bachem selective par-1 agonist tfllr-amide tfllr-nh 2
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Selective Par 1 Agonist Tfllr Amide Tfllr Nh 2, supplied by Bachem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/selective par-1 agonist tfllr-amide tfllr-nh 2/product/Bachem
Average 90 stars, based on 1 article reviews
selective par-1 agonist tfllr-amide tfllr-nh 2 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Bachem grgesp peptides
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Grgesp Peptides, supplied by Bachem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/grgesp peptides/product/Bachem
Average 90 stars, based on 1 article reviews
grgesp peptides - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Genotech Corp control odn 1720 (tccatgagcttcctgatgct, inactive control for cpg odn 1668)
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Control Odn 1720 (Tccatgagcttcctgatgct, Inactive Control For Cpg Odn 1668), supplied by Genotech Corp, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/control odn 1720 (tccatgagcttcctgatgct, inactive control for cpg odn 1668)/product/Genotech Corp
Average 90 stars, based on 1 article reviews
control odn 1720 (tccatgagcttcctgatgct, inactive control for cpg odn 1668) - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
PolyPeptide Laboratories inactive negative control peptide
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Inactive Negative Control Peptide, supplied by PolyPeptide Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/inactive negative control peptide/product/PolyPeptide Laboratories
Average 90 stars, based on 1 article reviews
inactive negative control peptide - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
GenScript corporation inactive control peptide (2 mm)
Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: <t>G2CT).</t> C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).
Inactive Control Peptide (2 Mm), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/inactive control peptide (2 mm)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
inactive control peptide (2 mm) - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
LifeTein Inc inactive control peptide tg3
Peptidomimetic blockade of MYB triggers cell death in T‐ALL. (A, B) Line chart of the ratio of luminescence detected using CellTiter‐Glo cell viability assay (hereafter called relative viability) upon treatment of cell lines with 10–40 µM of MYBMIM (colored line) or its inactive version, named <t>TG3</t> (black line), normalized to the untreated condition. (A) MyPL1 and MyPL2 are murine R26‐Myb tg/tg ; Pten fl/fl ; Lck‐Cre tg/+ T‐ALL cell lines. (B) RPMI‐8402, P12‐Ichikawa, Loucy, KOPT‐K1, and Jurkat are human T‐ALL cell lines. (C) Bar chart showing the relative viability of Jurkat and KOPT‐K1 cells at the beginning of the experiment (0 h), and 48 h later, when treated with either 30 µM (for Jurkat) or 20 µM (for KOPT‐K1) of MYBMIM, TG3, or untreated (CTR 48 h). (D) Stacked bar charts showing the percentage of cells per phase of the cell cycle and (E) the percentage of viable, early apoptotic, or late apoptotic cells at 48 h. A representative result from two independent experiments is shown. (F) Scheme of generation of T‐ALL patient‐derived xenografts (PDXs) through intravenous injections, followed by their ex vivo treatment with either TG3 or MYBMIM. (G) Line chart of the relative viability of T‐ALL PDX with either chromosomal translocation ( TRB::MYB ), genomic gain of MYB ( MYB CNG), or wild‐type MYB ( MYB WT), upon treatment with 10–40 µM of MYBMIM (colored line) or TG3 (black line), normalized to the untreated condition.
Inactive Control Peptide Tg3, supplied by LifeTein Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/inactive control peptide tg3/product/LifeTein Inc
Average 90 stars, based on 1 article reviews
inactive control peptide tg3 - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

90
Mebio Inc kinase-inactive control
Peptidomimetic blockade of MYB triggers cell death in T‐ALL. (A, B) Line chart of the ratio of luminescence detected using CellTiter‐Glo cell viability assay (hereafter called relative viability) upon treatment of cell lines with 10–40 µM of MYBMIM (colored line) or its inactive version, named <t>TG3</t> (black line), normalized to the untreated condition. (A) MyPL1 and MyPL2 are murine R26‐Myb tg/tg ; Pten fl/fl ; Lck‐Cre tg/+ T‐ALL cell lines. (B) RPMI‐8402, P12‐Ichikawa, Loucy, KOPT‐K1, and Jurkat are human T‐ALL cell lines. (C) Bar chart showing the relative viability of Jurkat and KOPT‐K1 cells at the beginning of the experiment (0 h), and 48 h later, when treated with either 30 µM (for Jurkat) or 20 µM (for KOPT‐K1) of MYBMIM, TG3, or untreated (CTR 48 h). (D) Stacked bar charts showing the percentage of cells per phase of the cell cycle and (E) the percentage of viable, early apoptotic, or late apoptotic cells at 48 h. A representative result from two independent experiments is shown. (F) Scheme of generation of T‐ALL patient‐derived xenografts (PDXs) through intravenous injections, followed by their ex vivo treatment with either TG3 or MYBMIM. (G) Line chart of the relative viability of T‐ALL PDX with either chromosomal translocation ( TRB::MYB ), genomic gain of MYB ( MYB CNG), or wild‐type MYB ( MYB WT), upon treatment with 10–40 µM of MYBMIM (colored line) or TG3 (black line), normalized to the untreated condition.
Kinase Inactive Control, supplied by Mebio Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/kinase-inactive control/product/Mebio Inc
Average 90 stars, based on 1 article reviews
kinase-inactive control - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

Image Search Results


Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: G2CT). C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).

Journal: The Journal of Neuroscience

Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories

doi: 10.1523/JNEUROSCI.3333-15.2016

Figure Lengend Snippet: Cannula placements. A, Figure 1D–F (white circles: Ctrl; black circles: GluA23Y). B, Figure 2A–C (white circles: Ctrl; black circles: G2CT). C, Figure 2D–F (white circles: Ctrl; black circles: GluA23Y). D, Figure 3A–C (white circles: PI; black circles: RI). E, Figure 3D–F (white circles: Ctrl; black circles GluA23Y). F, Figure 4D–F (white circles: Ctrl; black circles GluA23Y). G, Figure 5D–F (white circles: Ctrl; black circles GluA23Y). H, Figure 6A–C (white circles: Ctrl; black circles GluA23Y).

Article Snippet: The peptides G2CT and inactive control G2CT variant were purchased from AnaSpec.

Techniques:

Interfering with AP2-dependent GluA2/AMPAR removal and delayed onset of GluA23Y infusions prevent forgetting of long-term object location memories. A–C, Inhibiting AP2-dependent synaptic removal of GluA2/AMPARs prevents forgetting (see Fig. 8B for cannula placements). A, Animals were trained as before (Fig. 1D), but instead of GluA23Y, the peptide G2CT (n = 7, inactive control peptide, Ctrl, n = 7) was infused to interfere with the binding of AP2 to GluA2 to attenuate activity-dependent synaptic removal of GluA2/AMPARs. B, Only animals infused with G2CT preferred exploring the object at the new location, expressing significantly stronger novelty preference than the animals infused with the inactive control peptide (Ctrl). C, There were no group differences in exploratory activity. D–F, Infusing GluA23Y can prolong remote memories shortly before they would be naturally forgotten (see Fig. 8C for cannula placements). D, Seven days after the last training session (i.e., on day 8 after training), shortly before rats normally would forget the location memory (see Fig. 1A–C), animals received GluA23Y infusions into the dorsal hippocampus twice daily for 6 d. Twenty-four hours after the last infusion (or 14 d after the end of training), memory for object location was assessed by moving one of the objects to a novel location. E, Animals infused with GluA23Y (n = 7) preferred to explore the object at the new location, whereas animals that had received the inactive control variant (Ctrl, n = 6) explored both objects for an equal amount of time. The group difference was significant. F, Exploratory activity was the same for both groups.

Journal: The Journal of Neuroscience

Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories

doi: 10.1523/JNEUROSCI.3333-15.2016

Figure Lengend Snippet: Interfering with AP2-dependent GluA2/AMPAR removal and delayed onset of GluA23Y infusions prevent forgetting of long-term object location memories. A–C, Inhibiting AP2-dependent synaptic removal of GluA2/AMPARs prevents forgetting (see Fig. 8B for cannula placements). A, Animals were trained as before (Fig. 1D), but instead of GluA23Y, the peptide G2CT (n = 7, inactive control peptide, Ctrl, n = 7) was infused to interfere with the binding of AP2 to GluA2 to attenuate activity-dependent synaptic removal of GluA2/AMPARs. B, Only animals infused with G2CT preferred exploring the object at the new location, expressing significantly stronger novelty preference than the animals infused with the inactive control peptide (Ctrl). C, There were no group differences in exploratory activity. D–F, Infusing GluA23Y can prolong remote memories shortly before they would be naturally forgotten (see Fig. 8C for cannula placements). D, Seven days after the last training session (i.e., on day 8 after training), shortly before rats normally would forget the location memory (see Fig. 1A–C), animals received GluA23Y infusions into the dorsal hippocampus twice daily for 6 d. Twenty-four hours after the last infusion (or 14 d after the end of training), memory for object location was assessed by moving one of the objects to a novel location. E, Animals infused with GluA23Y (n = 7) preferred to explore the object at the new location, whereas animals that had received the inactive control variant (Ctrl, n = 6) explored both objects for an equal amount of time. The group difference was significant. F, Exploratory activity was the same for both groups.

Article Snippet: The peptides G2CT and inactive control G2CT variant were purchased from AnaSpec.

Techniques: Binding Assay, Activity Assay, Expressing, Variant Assay

Exploratory behavior during training sessions

Journal: The Journal of Neuroscience

Article Title: Blocking Synaptic Removal of GluA2-Containing AMPA Receptors Prevents the Natural Forgetting of Long-Term Memories

doi: 10.1523/JNEUROSCI.3333-15.2016

Figure Lengend Snippet: Exploratory behavior during training sessions

Article Snippet: The peptides G2CT and inactive control G2CT variant were purchased from AnaSpec.

Techniques:

Peptidomimetic blockade of MYB triggers cell death in T‐ALL. (A, B) Line chart of the ratio of luminescence detected using CellTiter‐Glo cell viability assay (hereafter called relative viability) upon treatment of cell lines with 10–40 µM of MYBMIM (colored line) or its inactive version, named TG3 (black line), normalized to the untreated condition. (A) MyPL1 and MyPL2 are murine R26‐Myb tg/tg ; Pten fl/fl ; Lck‐Cre tg/+ T‐ALL cell lines. (B) RPMI‐8402, P12‐Ichikawa, Loucy, KOPT‐K1, and Jurkat are human T‐ALL cell lines. (C) Bar chart showing the relative viability of Jurkat and KOPT‐K1 cells at the beginning of the experiment (0 h), and 48 h later, when treated with either 30 µM (for Jurkat) or 20 µM (for KOPT‐K1) of MYBMIM, TG3, or untreated (CTR 48 h). (D) Stacked bar charts showing the percentage of cells per phase of the cell cycle and (E) the percentage of viable, early apoptotic, or late apoptotic cells at 48 h. A representative result from two independent experiments is shown. (F) Scheme of generation of T‐ALL patient‐derived xenografts (PDXs) through intravenous injections, followed by their ex vivo treatment with either TG3 or MYBMIM. (G) Line chart of the relative viability of T‐ALL PDX with either chromosomal translocation ( TRB::MYB ), genomic gain of MYB ( MYB CNG), or wild‐type MYB ( MYB WT), upon treatment with 10–40 µM of MYBMIM (colored line) or TG3 (black line), normalized to the untreated condition.

Journal: HemaSphere

Article Title: Myb overexpression synergizes with the loss of Pten and is a dependency factor and therapeutic target in T‐cell lymphoblastic leukemia

doi: 10.1002/hem3.51

Figure Lengend Snippet: Peptidomimetic blockade of MYB triggers cell death in T‐ALL. (A, B) Line chart of the ratio of luminescence detected using CellTiter‐Glo cell viability assay (hereafter called relative viability) upon treatment of cell lines with 10–40 µM of MYBMIM (colored line) or its inactive version, named TG3 (black line), normalized to the untreated condition. (A) MyPL1 and MyPL2 are murine R26‐Myb tg/tg ; Pten fl/fl ; Lck‐Cre tg/+ T‐ALL cell lines. (B) RPMI‐8402, P12‐Ichikawa, Loucy, KOPT‐K1, and Jurkat are human T‐ALL cell lines. (C) Bar chart showing the relative viability of Jurkat and KOPT‐K1 cells at the beginning of the experiment (0 h), and 48 h later, when treated with either 30 µM (for Jurkat) or 20 µM (for KOPT‐K1) of MYBMIM, TG3, or untreated (CTR 48 h). (D) Stacked bar charts showing the percentage of cells per phase of the cell cycle and (E) the percentage of viable, early apoptotic, or late apoptotic cells at 48 h. A representative result from two independent experiments is shown. (F) Scheme of generation of T‐ALL patient‐derived xenografts (PDXs) through intravenous injections, followed by their ex vivo treatment with either TG3 or MYBMIM. (G) Line chart of the relative viability of T‐ALL PDX with either chromosomal translocation ( TRB::MYB ), genomic gain of MYB ( MYB CNG), or wild‐type MYB ( MYB WT), upon treatment with 10–40 µM of MYBMIM (colored line) or TG3 (black line), normalized to the untreated condition.

Article Snippet: Murine and human T‐ALL cells were cultured at a density of 10,000 cells/mL and treated with either the peptidomimetic MYBMIM or the inactive control peptide TG3, which were synthetized by LifeTein.

Techniques: Viability Assay, Derivative Assay, Ex Vivo, Translocation Assay